About   Help   FAQ
AF7, AF8 Primer Detail
Primers
  • Name
    AF7, AF8
  • Primer 1 Sequence
    TCCCCGCGGCTCAGCTTTTGAATTGGGAA
  • Primer 2 Sequence
    AAATCGATCTCCTGTTGCTTTGCTGTA
  • ID
    MGI:1889645
  • Region Covered
    exon 4
Genes
Msr1 macrophage scavenger receptor 1
Polymorphisms
J:64317 Fortin A, et al., Mamm Genome. 2000 Sep;11(9):779-85
Endonuclease Gene Allele Fragments Strains
Msr1 a not given 129/Sv, A/J, BALB/cJ, C3H/HeJ, CBA/J, CZECHII/EiJ, DBA/1J, DBA/2J, SJL/J, ZALENDE/EiJ
b not given C57BL/6J, C57L/J, CAST/EiJ, MOLF/EiJ
s not given SPRET/EiJ
w not given WSB/EiJ
References
J:64317 Fortin A, et al., Identification and characterization of naturally occurring variants of the macrophage scavenger receptor (SR-A). Mamm Genome. 2000 Sep;11(9):779-85

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/05/2019
MGI 6.14
The Jackson Laboratory