About   Help   FAQ
Epcs26F, Epcs26R Primer Detail
Primers
  • Name
    Epcs26F, Epcs26R
  • Primer 1 Sequence
    CGACAGATTGGTTCATGGTC
  • Primer 2 Sequence
    GGCATCTATTTGGCTGACAG
  • ID
    MGI:1860304
Genes
Plac1 placental specific protein 1
Polymorphisms
J:62506 Hemberger M, et al., Dev Biol. 2000 Jun 1;222(1):158-69
Endonuclease Gene Allele Fragments Strains
Plac1 b not given C57BL/6
s not given M. spretus
References
J:62506 Hemberger M, et al., cDNA subtraction cloning reveals novel genes whose temporal and spatial expression indicates association with trophoblast invasion. Dev Biol. 2000 Jun 1;222(1):158-69

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory