About   Help   FAQ
Celsr2-pA, Celsr2-pB Primer Detail
Primers
  • Name
    Celsr2-pA, Celsr2-pB
  • Primer 1 Sequence
    TACGGAGATTCGGCTGGCTC
  • Primer 2 Sequence
    CCAGGACCCAGCAGGCTGTC
  • ID
    MGI:1858485
Genes
Celsr2 cadherin, EGF LAG seven-pass G-type receptor 2
Polymorphisms
J:61652 Formstone CJ, et al., Mamm Genome. 2000 May;11(5):392-4
Endonuclease Gene Allele Fragments Strains
MspI Celsr2 b not given C57BL/6
s not given M. spretus
References
J:61652 Formstone CJ, et al., Chromosomal localization of Celsr2 and Celsr3 in the mouse; Celsr3 is a candidate for the tippy (tip) lethal mutant on chromosome 9. Mamm Genome. 2000 May;11(5):392-4

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Tumor Biology (MTB), Gene Ontology (GO), MouseCyc
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/18/2018
MGI 6.12
The Jackson Laboratory