About   Help   FAQ
C3ar-1f, C3ar-1r Primer Detail
Primers
  • Name
    C3ar-1f, C3ar-1r
  • Primer 1 Sequence
    TTTTCTCACTGAGGCATCTATTCAG
  • Primer 2 Sequence
    TAGACAAGTGAGACCAAGAATGACC
  • ID
    MGI:1355545
Genes
C3ar1 complement component 3a receptor 1
Polymorphisms
J:61131 Lawson PR, et al., Int Immunol. 2000 Mar;12(3):231-40
Endonuclease Gene Allele Fragments Strains
ApaLI C3ar1 b 0.7kb C57BL/6
s 0.45, 0.25kb M. spretus
References
J:61131 Lawson PR, et al., A novel PCR-based technique using expressed sequence tags and gene homology for murine genetic mapping: localization of the complement genes. Int Immunol. 2000 Mar;12(3):231-40

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/08/2019
MGI 6.14
The Jackson Laboratory