About   Help   FAQ
D10Mit311 Primer Detail
Primers
  • Name
    D10Mit311
  • Primer 1 Sequence
    GAGGTGAAGTCATTAGTACCTAAGGC
  • Primer 2 Sequence
    TTCAGAATTTCTCAGACTCCTCG
  • ID
    MGI:1347924
  • Product Size
    106
  • Other IDs
    141518 (NCBI UniSTS)
    D10Mit311 (BROAD)
  • Note
    MIT assay: MT3745
Genes
D10Mit311 DNA Segment, Chr 10, Massachusetts Institute of Technology-311
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory