About   Help   FAQ
D2Dcr29-pA, D2Dcr29-pB Primer Detail
Primers
  • Name
    D2Dcr29-pA, D2Dcr29-pB
  • Primer 1 Sequence
    GACCTGGCTGGCCTAGAGCTC
  • Primer 2 Sequence
    ACTGTGAGTTTCAGAACAGCC
  • ID
    MGI:1333175
  • Region Covered
    clone P1-44 T7 end
  • Product Size
    0.318kb
  • Other IDs
    142304 (NCBI UniSTS)
Genes
D2Dcr29 DNA segment, Chr 2, Derry C. Roopenian 29
Polymorphisms
J:51335 Zuberi AR, et al., Immunity. 1998 Nov;9(5):687-98
Notes: Polymorphisms were detected by using SSCP.
Endonuclease Gene Allele Fragments Strains
D2Dcr29 b not given C57BL/10
s not given 129
References
J:51335 Zuberi AR, et al., Positional cloning and molecular characterization of an immunodominant cytotoxic determinant of the mouse H3 minor histocompatibility complex. Immunity. 1998 Nov;9(5):687-98
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory