About   Help   FAQ
D9Mgc28-pA, D9Mgc28-pB Primer Detail
Primers
  • Name
    D9Mgc28-pA, D9Mgc28-pB
  • Primer 1 Sequence
    TTGGTTTTCAGTCTGTGGTTCA
  • Primer 2 Sequence
    AGCTTTAATTATCCAAGCACGGT
  • ID
    MGI:1331035
  • Product Size
    188bp
  • Other IDs
    142768 (NCBI UniSTS)
Genes
D9Mgc28 DNA segment, Chr 9, MRC UK Mouse Genome Centre 28
References
J:52081 Blanco G, et al., A STS content physical and transcription map across the ky, kyphoscoliosis, nonrecombinant region. Genomics. 1998 Dec 15;54(3):415-23
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/05/2019
MGI 6.14
The Jackson Laboratory