About   Help   FAQ
Due to maintenance, access to MGI may be intermittent 8:00 AM ET Wed, September 18.
D1Ncl1-pA, D1Ncl1-pB Primer Detail
Primers
  • Name
    D1Ncl1-pA, D1Ncl1-pB
  • Primer 1 Sequence
    AACTGCTAGTATCGTGCAC
  • Primer 2 Sequence
    GTGAGGACTTTTGCACACAA
  • ID
    MGI:1330784
  • Region Covered
    part of intron 1 of Gls
  • Product Size
    0.18kb
Genes
Gls glutaminase
Polymorphisms
J:51779 Levy N, et al., Genomics. 1998 Dec 1;54(2):355-6
Endonuclease Gene Allele Fragments Strains
Gls b 0.108kb C57BL/6JEiJ
h 0.096kb C3H/HeJ
s 0.070kb SPRET/EiJ
References
J:51779 Levy N, et al., Physical and genetic linkage of glutaminase (Gls), signal transducer and activator of transcription 1 (Stat1), and xeroderma pigmentosum complementation group G (Xpg) on mouse proximal chromosome 1. Genomics. 1998 Dec 1;54(2):355-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/10/2019
MGI 6.14
The Jackson Laboratory