About   Help   FAQ
Trrp2-pA, Trrp2-pB Primer Detail
Primers
  • Name
    Trrp2-pA, Trrp2-pB
  • Primer 1 Sequence
    TGGACATGCCTCAGTTCCTGG
  • Primer 2 Sequence
    TTTCCACTCCACATCAGCATC
  • ID
    MGI:1277863
Genes
Trpc2 transient receptor potential cation channel, subfamily C, member 2
Polymorphisms
J:49394 Yamazaki K, et al., Genomics. 1998 Jul 15;51(2):303-5
Endonuclease Gene Allele Fragments Strains
DdeI Trpc2 b 150, 200, 350bp C57BL/6JEiJ
s 200, 500bp SPRET/EiJ
References
J:49394 Yamazaki K, et al., Genetic mapping of mouse transient receptor potential (Trrp) genes responsible for capacitative calcium entry channels to chromosomes 3, 7, 9, and X. Genomics. 1998 Jul 15;51(2):303-5

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/11/2019
MGI 6.14
The Jackson Laboratory