About   Help   FAQ
A412 Primer Detail
Primers
  • Name
    A412
  • Primer 1 Sequence
    GGCTAGGTACGATACTGCCT
  • Primer 2 Sequence
    TTGCATAGTTAAGCAACCGT
  • ID
    MGI:1206374
  • Product Size
    199
Genes
Rufy2 RUN and FYVE domain-containing 2
References
J:44483 Brady KP, et al., Genetic mapping of 262 loci derived from expressed sequences in a murine interspecific cross using single-strand conformational polymorphism analysis. Genome Res. 1997 Nov;7(11):1085-93

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/12/2019
MGI 6.14
The Jackson Laboratory