Creb1em1Rst
Endonuclease-mediated Allele Detail
|
Symbol: |
Creb1em1Rst |
Name: |
cAMP responsive element binding protein 1; endonuclease-mediated mutation 1, Randal S Tibbetts |
MGI ID: |
MGI:6783446 |
Synonyms: |
CrebE153D |
Gene: |
Creb1 Location: Chr1:64571963-64643707 bp, + strand Genetic Position: Chr1, 32.74 cM, cytoband C1/C5
|
Alliance: |
Creb1em1Rst page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Not Specified) |
Mutation: |
|
Single point mutation
|
|
|
Mutation details: Glutamic acid codon 153 (GAA) was targeted for change to an aspartic acid codon (GAC)(p.E153D) with an sgRNA (targeting GACTTTTCTTCTTCAATCCTTGG) and an ssODN template using CRISPR/Cas9 technology. This mutation disrupts the BS2 binding site that normally allows binding of protein phosphatase 2A through the PP2A B56 regulatory subunits.
(J:307293)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Creb1 Mutation: |
59 strains or lines available
|
|
Original: |
J:307293 Kim SH, et al., Roles of constitutive and signal-dependent protein phosphatase 2A docking motifs in burst-attenuation of the cyclic AMP response element binding protein. J Biol Chem. 2021 Jun 22;:100908 |
All: |
1 reference(s) |
|