Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Lbrem1Mad
Name:	lamin B receptor; endonuclease-mediated mutation 1, Michael A Dyer
MGI ID:	MGI:6469611
Synonyms:	LbrLox
Gene:	Lbr  Location: Chr1:181642880-181669966 bp, - strand  Genetic Position: Chr1, 84.89 cM
Alliance:	Lbrem1Mad page

Strain of Origin:

C57BL/6J

Allele Type:    Endonuclease-mediated (Conditional ready) Mutation:    Insertion   Mutation details: CRISPR/cas9 endonuclease-mediated genome editing was used with sgRNAs (GGAACUUUAUUUGGATCAGG and GGUUCCUUAGGCUCUUGUGA) and two ssODN templates to flank exon 10 with loxP sites. (J:282593)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Lbr Mutation:	55 strains or lines available

Original:	J:282593 Norrie JL, et al., Nucleome Dynamics during Retinal Development. Neuron. 2019 Nov 6;104(3):512-528.e11
All:	1 reference(s)