Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Rr272em1Mad
Name:	regulatory region 272; endonuclease-mediated mutation 1, Michael A Dyer
MGI ID:	MGI:6469562
Synonyms:	Vsx2 CRC-SEdelta, Vsx2em1Mad, Vsx2-SEdelta
Gene:	Rr272  Location: unknown  Genetic Position: Chr12, Syntenic
Alliance:	Rr272em1Mad page

Strain of Origin:

C57BL/6J

Allele Type:    Endonuclease-mediated (Modified regulatory region) Mutation:    Intergenic deletion   Rr272em1Mad involves 6 genes/genome features (Rr276, Rr274, Rr275 ...) View all   Mutation details: This Vsx2 bipolar neuron-specific core regulatory circuit super enhancer (CRC-SE) was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in slightly different deletions in three independent lines: chr12:84579812-84611543 (Vsx2-3-3), 84579815-84611547 (Vsx2-59-12) and 84579815-84611546 (Vsx2-23-3); all coordinates from build GRCm39. The deletions involve super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52. (J:282593)

View phenotypes and curated references for all genotypes (concatenated display).

In Mice Carrying this Mutation:	2 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr272 Mutation:	0 strains or lines available

Original:	J:282593 Norrie JL, et al., Nucleome Dynamics during Retinal Development. Neuron. 2019 Nov 6;104(3):512-528.e11
All:	3 reference(s)