Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Roraem1Litt
Name:	RAR-related orphan receptor alpha; endonuclease-mediated mutation 1, Dan R LIttman
MGI ID:	MGI:6467242
Synonyms:	Rora-TS
Gene:	Rora  Location: Chr9:68561068-69295528 bp, + strand  Genetic Position: Chr9, 37.45 cM
Alliance:	Roraem1Litt page

Strain of Origin:

C57BL/6J

Allele Type:    Endonuclease-mediated (Not Applicable) Mutation:    Insertion   Mutation details: CRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon immediately before the stop codon. TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rora exon: CGGAAAAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTCCATTTTCCTCCATTATACAAGGAATTGTTCACTTCAGAATTTGAGCCAGCTATGCAGATTGACGGA] gcaagcggatcggcttcaggatcggcctct TGGTCTCACCCACAGTTCGAGAAG ggaggcggatccggaggtgggtctggcggatccgct TGGTCCCATCCTCAGTTTGAAAAG [TAA stop]. (J:336987)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rora Mutation:	41 strains or lines available

Original:	J:336987 Hall JA, et al., Transcription factor RORalpha enforces stability of the Th17 cell effector program by binding to a Rorc cis-regulatory element. Immunity. 2022 Nov 8;55(11):2027-2043.e9
All:	1 reference(s)