Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Irf5em1(IMPC)Bay
Name:	interferon regulatory factor 5; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID:	MGI:6453611
Gene:	Irf5  Location: Chr6:29526624-29541870 bp, + strand  Genetic Position: Chr6, 12.36 cM
Alliance:	Irf5em1(IMPC)Bay page
IMPC:	Irf5 gene page

Strain of Origin:	C57BL/6N
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Not Specified) Mutation:    Single point mutation   Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and the guide sequence CCCTCGGGACATGCCACCTCAGC, which resulted in a Point Mutation allele. (J:265051) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Irf5 Mutation:	28 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	2 reference(s)