Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Hoxb4em1(IMPC)H
Name:	homeobox B4; endonuclease-mediated mutation 1, Harwell
MGI ID:	MGI:6414500
Gene:	Hoxb4  Location: Chr11:96209093-96212464 bp, + strand  Genetic Position: Chr11, 59.83 cM
Alliance:	Hoxb4em1(IMPC)H page
IMPC:	Hoxb4 gene page

Strain of Origin:	C57BL/6NTac
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutations:    Insertion, Intragenic deletion   Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 2 guide sequences TCGCCCGGGTACTACGCCGGCGG, CACTCGCCCGGGTACTACGCCGG, which resulted in a Indel. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Hoxb4 Mutation:	18 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	1 reference(s)