About   Help   FAQ
Grb10em1(IMPC)H
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Grb10em1(IMPC)H
Name: growth factor receptor bound protein 10; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6414470
Gene: Grb10  Location: Chr11:11930499-12037428 bp, - strand  Genetic Position: Chr11, 7.15 cM
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences CAACCGAAGGAGGGCTCCCAGGG, GGGGCCGCACCAGTGAGCTCCGG, GAGCGTTGCATTTTCTGCCTCGG, CCTGTGGCTGTCCCCGGGAGCTA, which resulted in a Indel. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Grb10 Mutation:  30 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/30/2020
MGI 6.15
The Jackson Laboratory