Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Grb10em1(IMPC)H
Name:	growth factor receptor bound protein 10; endonuclease-mediated mutation 1, Harwell
MGI ID:	MGI:6414470
Gene:	Grb10  Location: Chr11:11880499-11987428 bp, - strand  Genetic Position: Chr11, 7.15 cM
Alliance:	Grb10em1(IMPC)H page
IMPC:	Grb10 gene page

Strain of Origin:	C57BL/6NTac
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutations:    Insertion, Intragenic deletion   Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences CAACCGAAGGAGGGCTCCCAGGG, GGGGCCGCACCAGTGAGCTCCGG, GAGCGTTGCATTTTCTGCCTCGG, CCTGTGGCTGTCCCCGGGAGCTA, which resulted in a Indel. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Grb10 Mutation:	53 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	1 reference(s)