Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Vcanem1(IMPC)Mbp
Name:	versican; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID:	MGI:6382412
Gene:	Vcan  Location: Chr13:89803431-89890628 bp, - strand  Genetic Position: Chr13, 45.5 cM
Alliance:	Vcanem1(IMPC)Mbp page
IMPC:	Vcan gene page

Strain of Origin:	C57BL/6NCrl
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences TCACTCGTGTTGTAATTGGGTGG, TCCCATACATGACATCACATCGG, which resulted in a Exon Deletion. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Vcan Mutation:	164 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	1 reference(s)