Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Ube2e3em1(IMPC)Ccpcz
Name:	ubiquitin-conjugating enzyme E2E 3; endonuclease-mediated mutation 1, Institute of Molecular Genetics
MGI ID:	MGI:6367969
Gene:	Ube2e3  Location: Chr2:78698468-78751637 bp, + strand  Genetic Position: Chr2, 47.15 cM, cytoband D
Alliance:	Ube2e3em1(IMPC)Ccpcz page
IMPC:	Ube2e3 gene page

Strain of Origin:	C57BL/6NCrl
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCTGTCTTGGACTAGATTAACCT, TGTGATACAAAACTGACGAGTGG, which resulted in a Exon Deletion. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ube2e3 Mutation:	13 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	1 reference(s)