Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Etv4em1(IMPC)Kmpc
Name:	ets variant 4; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
MGI ID:	MGI:6336119
Gene:	Etv4  Location: Chr11:101660568-101676197 bp, - strand  Genetic Position: Chr11, 65.48 cM
Alliance:	Etv4em1(IMPC)Kmpc page
IMPC:	Etv4 gene page

Strain of Origin:	C57BL/6NTac
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and 2 guide sequences TCCCCACTGGTGATAAGGGACGG, CCCCCGAATCACCCTGAGGAGTC, which resulted in a Exon Deletion. (J:237616)

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Etv4 Mutation:	40 strains or lines available

Original:	J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:	2 reference(s)