Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Spi1em1(IMPC)Wtsi
Name:	Spi-1 proto-oncogene; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID:	MGI:6281103
Gene:	Spi1  Location: Chr2:90912750-90946104 bp, + strand  Genetic Position: Chr2, 50.44 cM, cytoband E3
Alliance:	Spi1em1(IMPC)Wtsi page
IMPC:	Spi1 gene page

Strain of Origin:	C57BL/6N
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated Mutation:    Single point mutation   Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence TCACCGCCCCTGTGAGTACTGGG, and a donor oligo, which resulted in a Point Mutation allele. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Spi1 Mutation:	27 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	1 reference(s)