About   Help   FAQ
Due to maintenance, access to MGI may be intermittent 8:00 AM ET Wed, September 18.
Spi1em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Spi1em1(IMPC)Wtsi
Name: spleen focus forming virus (SFFV) proviral integration oncogene; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6281103
Gene: Spi1  Location: Chr2:91082390-91115756 bp, + strand  Genetic Position: Chr2, 50.44 cM, cytoband E3
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated
Mutation:    Single point mutation
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence TCACCGCCCCTGTGAGTACTGGG, and a donor oligo, which resulted in a Point Mutation allele. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Spi1 Mutation:  20 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/05/2019
MGI 6.14
The Jackson Laboratory