Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Abatem1(IMPC)Bay
Name:	4-aminobutyrate aminotransferase; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID:	MGI:6257633
Gene:	Abat  Location: Chr16:8331293-8439432 bp, + strand  Genetic Position: Chr16, 4.06 cM, cytoband A3
Alliance:	Abatem1(IMPC)Bay page
IMPC:	Abat gene page

Strain of Origin:	C57BL/6N
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Conditional ready, Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA, 2 guide sequences TGTTGTGGTCTGCCTAATGTGGG, CCATTGTGAAGGCTTCAAAGGTG, and a donor oligo, which resulted in a Conditional Ready allele. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Abat Mutation:	94 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	1 reference(s)