Gng11em3(IMPC)H
Endonuclease-mediated Allele Detail
|
Symbol: |
Gng11em3(IMPC)H |
Name: |
guanine nucleotide binding protein (G protein), gamma 11; endonuclease-mediated mutation 3, Harwell |
MGI ID: |
MGI:6155633 |
Gene: |
Gng11 Location: Chr6:4003987-4008445 bp, + strand Genetic Position: Chr6, 1.81 cM, cytoband A1
|
Alliance: |
Gng11em3(IMPC)H page
|
IMPC: |
Gng11 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 2 guide sequences CCCTTCACATCGAGGATCTGCCG, CATCGAGGATCTGCCGGAAAAGG, which resulted in a Indel.
(J:237616)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Gng11 Mutation: |
11 strains or lines available
|
|
Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
All: |
1 reference(s) |
|