Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Prkd1em2(IMPC)Wtsi
Name:	protein kinase D1; endonuclease-mediated mutation 2, Wellcome Trust Sanger Institute
MGI ID:	MGI:6153770
Gene:	Prkd1  Location: Chr12:50388014-50695881 bp, - strand  Genetic Position: Chr12, 21.78 cM, cytoband C1
Alliance:	Prkd1em2(IMPC)Wtsi page
IMPC:	Prkd1 gene page

Strain of Origin:	C57BL/6N
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Not Specified) Mutation:    Single point mutation   Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence CCGGAACCCAGAACTTCATCAGG, and a donor oligo, which resulted in a Point Mutation allele. (J:237616)

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Prkd1 Mutation:	55 strains or lines available

Original:	J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:	2 reference(s)