Chd3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Chd3em1(IMPC)J |
Name: |
chromodomain helicase DNA binding protein 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5818701 |
Synonyms: |
Chd3em1J |
Gene: |
Chd3 Location: Chr11:69234099-69260232 bp, - strand Genetic Position: Chr11, 42.53 cM
|
Alliance: |
Chd3em1(IMPC)J page
|
IMPC: |
Chd3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Chd3-8127J-F9396 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTACCAGGCTAGAGAAAGTG, TTCTTTCTCTCAGATGGCGA, TGACCTCCATTCAGAACCAG and GTTCCTAGAGAGTGCCACGG, which resulted in a 343 bp deletion beginning at Chromosome 11 negative strand position 69,364,877 bp, ACGGTGGCAGTAAGAAGGGG, and ending after ACTTGGAACCCTAACCCCAC at 69,364,535 bp (GRCm38/mm10). This mutation deletes exon 2 and 230 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 2 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|