Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Chd3em1(IMPC)J
Name:	chromodomain helicase DNA binding protein 3; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5818701
Synonyms:	Chd3em1J
Gene:	Chd3  Location: Chr11:69234099-69260232 bp, - strand  Genetic Position: Chr11, 42.53 cM
Alliance:	Chd3em1(IMPC)J page
IMPC:	Chd3 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from project Chd3-8127J-F9396 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTACCAGGCTAGAGAAAGTG, TTCTTTCTCTCAGATGGCGA, TGACCTCCATTCAGAACCAG and GTTCCTAGAGAGTGCCACGG, which resulted in a 343 bp deletion beginning at Chromosome 11 negative strand position 69,364,877 bp, ACGGTGGCAGTAAGAAGGGG, and ending after ACTTGGAACCCTAACCCCAC at 69,364,535 bp (GRCm38/mm10). This mutation deletes exon 2 and 230 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 2 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Chd3 Mutation:	101 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)