Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Polr3aem2(IMPC)Tcp
Name:	polymerase (RNA) III (DNA directed) polypeptide A; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID:	MGI:5755039
Gene:	Polr3a  Location: Chr14:24498764-24537126 bp, - strand  Genetic Position: Chr14, 14.4 cM
Alliance:	Polr3aem2(IMPC)Tcp page
IMPC:	Polr3a gene page

Strain of Origin:	C57BL/6NCrl
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Insertion   Mutation details: This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA, the guide sequence CCGGCATTTATCTGAGATCTTCT, and a donor oligo, which resulted in a 1 bp insertion at Chr14:24482833_insT in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). (GRCm38). (J:165963)

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

2 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Polr3a Mutation:	70 strains or lines available

Original:	J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:	3 reference(s)