Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Polr3aem1(IMPC)Tcp
Name:	polymerase (RNA) III (DNA directed) polypeptide A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID:	MGI:5755028
Gene:	Polr3a  Location: Chr14:24498764-24537126 bp, - strand  Genetic Position: Chr14, 14.4 cM
Alliance:	Polr3aem1(IMPC)Tcp page
IMPC:	Polr3a gene page

Strain of Origin:	C57BL/6NCrl
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Not Specified   Mutation details: This allele produced from project TCPR0244 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence AGAAGATCTCAGATAAATGC and an oligonucleotide repair template encoding a 1-bp insertion. Homology-directed repair resulted in a 1 bp insertion at Chr14:24482833 in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). A silent change at p.R151 (CGG>CGC) was also introduced which disrupts the PAM sequence. (GRCm38). (J:165963)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Polr3a Mutation:	70 strains or lines available

Original:	J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:	2 reference(s)