Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Dolkem1(IMPC)J
Name:	dolichol kinase; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5605979
Synonyms:	Dolkem1J
Gene:	Dolk  Location: Chr2:30174243-30176346 bp, - strand  Genetic Position: Chr2, 21.49 cM
Alliance:	Dolkem1(IMPC)J page
IMPC:	Dolk gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from project Dolk-5942-1899 was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CGTAGAAGGCCTGCACCGCG and ACGTCCAGTACAAGTGGGAC, which resulted in a 25 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 30285881 (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 50 and early truncation 32 amino acids later. (J:188991)

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

3 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dolk Mutation:	14 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	4 reference(s)