Rr304^em1Drf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr304^em1Drf
• Name: regulatory region 304; endonuclease-mediated mutation 1, David R FitzPatrick
• MGI ID: MGI:7367486
• Synonyms: Tenm1^CRE
• Gene: Rr304 Location: unknown Genetic Position: ChrX, Syntenic
• Alliance: Rr304^em1Drf page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Single point mutation
• Mutation details: A G>A mutation was engineered in the Tenm1 cis-regulatory element (CRE) using an sgRNA (targeting AATATTATTAGCCACACATTTGG) and a ssODN template (TAAGATGGATTCATATTAGGGCTCAAATGCATTGATAGCATTCTACATATTTTTATCCATTTTTATTCCAAGCTACTTTTATCCAAATAGTTATAGACACAAGGTTATTGCAAATTGTATTTGTCTGCTGCCATAGTGCTTTCTATTTTAGAGGAGTAGAAGTAACTATCTCCTTAACAA) with CRISPR/Cas9 technology. The mutation mimics one found in some families with individuals presenting with X-linked intellectual disability (XLID). (J:308813)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr304 Mutation: 0 strains or lines available

References

• Original: J:308813 Bengani H, et al., Identification and functional modelling of plausibly causative cis-regulatory variants in a highly-selected cohort with X-linked intellectual disability. PLoS One. 2021;16(8):e0256181
• All: 1 reference(s)