About   Help   FAQ
Gaaem2Jhng
Endonuclease-mediated Allele Detail
Summary
Symbol: Gaaem2Jhng
Name: glucosidase, alpha, acid; endonuclease-mediated mutation 2, Jeffrey Huang
MGI ID: MGI:7327566
Synonyms: Gaac.1935CA>
Gene: Gaa  Location: Chr11:119158789-119176284 bp, + strand  Genetic Position: Chr11, 83.35 cM, cytoband D-E
Alliance: Gaaem2Jhng page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsGuide RNAs (CGCAGATGTCCGCCCCGACC and GCAGATGTCCGCCCCGACCA) were designed to create a GAC to GAA mutation at position 1935, resulting in an aspartic acid to glutamic acid change at amino acid 645 (Asp645Glu). This mutation has been identified as the most frequent GAA pathogenic mutation in people of Taiwanese and Southern Han Chinese ethnicity, causing infantile-onset Pompe disease (IOPD). A silent protospacer adjacent motif (PAM) site mutation (Gaa(c.1920C to T)) and a gRNA seed region mutation (Gaa(c.1923G to C)) were introduced, as well as two silent mutations (Gaa(c.1929G to A) and Gaa(c.1932G to A)) to prevent gRNA editing of the donor template. (J:341582)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gaa Mutation:  55 strains or lines available
References
Original:  J:341582 Kan SH, et al., CRISPR-mediated generation and characterization of a Gaa homozygous c.1935C>A (p.D645E) Pompe disease knock-in mouse model recapitulating human infantile onset-Pompe disease. Sci Rep. 2022 Dec 14;12(1):21576
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory