4933411K16Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: 4933411K16Rik^em1(IMPC)J
• Name: RIKEN cDNA 4933411K16 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6740198
• Gene: 4933411K16Rik Location: Chr19:42040687-42042066 bp, + strand Genetic Position: Chr19, 35.68 cM, cytoband D1
• Alliance: 4933411K16Rik^em1(IMPC)J page
• IMPC: 4933411K16Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGTCTTCTGTAGTCTCAG and AGCCATAGATTGGGTTTCTG, which resulted in an 863 bp deletion beginning at Chromosome 19 position 42,040,905 bp and ending after 42,041,767 bp (GRCm39/mm39). This mutation deletes 863 bp of ENSMUSE00000897965 (exon 1) is predicted to cause a change of amino acid sequence after residue 12 and termination 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any 4933411K16Rik Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)