About   Help   FAQ
Vcpip1em1Zlou
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Vcpip1em1Zlou
Name: valosin containing protein (p97)/p47 complex interacting protein 1; endonuclease-mediated mutation 1, Zhenkun Lou
MGI ID: MGI:6515598
Synonyms: Vcpip1-
Gene: Vcpip1  Location: Chr1:9788847-9818607 bp, - strand  Genetic Position: Chr1, 2.08 cM, cytoband A2
Mutation
origin
Strain of Origin:  C57BL/6NHsd
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Nucleotide substitutions
 
Mutation detailsThe gene was targeted with a crRNA/tracrRNA duplex (targeting TTCGGTCCCTTCGTTTCGAA) and an ssODN template (CCGGAAAGGATTCTTCGGTCCCTTCGTTTCCTACAACAGCTTAATTAAGGTTTAAACGCCATGACGAAAGGCCCCCCGGAGAAGCCGCCGCCGCCAGAGA) using CRISPR/Cas9 technology, resulting in the creation of premature stop codons in all three reading frames. Peptide expression from this alleles was absent from mouse embryo fibroblasts (MEFs). (J:297179)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 3 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Vcpip1 Mutation:  23 strains or lines available
References
Original:  J:297179 Huang J, et al., Tandem Deubiquitination and Acetylation of SPRTN Promotes DNA-Protein Crosslink Repair and Protects against Aging. Mol Cell. 2020 Sep 3;79(5):824-835.e5
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/27/2022
MGI 6.21
The Jackson Laboratory