About   Help   FAQ
Scimpem1Adiuj
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Scimpem1Adiuj
Name: SLP adaptor and CSK interacting membrane protein; endonuclease-mediated mutation 1, MODEL-AD Center
MGI ID: MGI:6444735
Gene: Scimp  Location: Chr11:70790932-70812561 bp, - strand  Genetic Position: Chr11, 43.21 cM
Mutation
origin
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsCRISPR/Cas9 genome editing using a single guide RNA (ACAGGCAAGAGGACAAGTCC) is designed to introduce a T-to-C point mutation upstream of the gene locus. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Scimp Mutation:  14 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/10/2020
MGI 6.16
The Jackson Laboratory