About   Help   FAQ
Tmem88bem1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Tmem88bem1(IMPC)Mbp
Name: transmembrane protein 88B; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6423830
Gene: Tmem88b  Location: Chr4:155866048-155870331 bp, - strand  Genetic Position: Chr4, 87.36 cM
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences ATCCACTTTACGGGGGTCGAGGG, CCGCGGGGCTTGAAGGATGTTCC, which resulted in a Whole-gene deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tmem88b Mutation:  6 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory