Pcdha9em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Pcdha9em1(IMPC)J |
Name: |
protocadherin alpha 9; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6385911 |
Gene: |
Pcdha9 Location: Chr18:37130933-37320710 bp, + strand Genetic Position: Chr18, 19.46 cM
|
Alliance: |
Pcdha9em1(IMPC)J page
|
IMPC: |
Pcdha9 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATAGTTCGCTGTTTCTCAG and TTAAAAATACTTGTGCATAG, which resulted in a 2665 bp deletion beginning at Chromosome 18 position 36,997,816 bp and ending after 37,000,480 bp (GRCm38/mm10). This mutation deletes 2665 bp from ENSMUSE00000703749 (exon 1) including the splice acceptor, start site and donor and is predicted to a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|