About   Help   FAQ
Camsap1em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Camsap1em1(IMPC)J
Name: calmodulin regulated spectrin-associated protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6361950
Gene: Camsap1  Location: Chr2:25816850-25873294 bp, - strand  Genetic Position: Chr2, 18.29 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCATCTGACCCTAATGGAA and ATGCCATCGGATTAAAGAAG, which resulted in an 826 bp deletion beginning at Chromosome 2 position 25,966,411 bp and ending after 25,967,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264038 (exon 2) and 563 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 21 amino acids later. There is a single bp (T) insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Camsap1 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/19/2021
MGI 6.17
The Jackson Laboratory