Clec3a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clec3a^em1(IMPC)J
• Name: C-type lectin domain family 3, member a; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357989
• Gene: Clec3a Location: Chr8:115144826-115152586 bp, + strand Genetic Position: Chr8, 60.96 cM
• Alliance: Clec3a^em1(IMPC)J page
• IMPC: Clec3a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCTCCTAATCCCTTTGGG and GTAGGCCCCCTCAGTAAACT, which resulted in a 730 bp deletion beginning at Chromosome 8 position 114,425,191 bp and ending after 114,425,920 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365573 (exon 3) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 23 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Clec3a Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)