Zyg11bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zyg11bem1(IMPC)J |
Name: |
zyg-ll family member B, cell cycle regulator; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6305141 |
Gene: |
Zyg11b Location: Chr4:108086921-108158293 bp, - strand Genetic Position: Chr4, 50.35 cM
|
Alliance: |
Zyg11bem1(IMPC)J page
|
IMPC: |
Zyg11b gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Insertion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTCCTTAAGACTTCATTA and AGATTCACTATTAGATACAT, which resulted in a 1055 bp deletion beginning at Chromosome 4 position 108,265,749 bp and ending after 108,266,803 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000601600 (exon 3) and 300 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 22 amino acids later. There is a single bp insertion (G) at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|