About   Help   FAQ
Del(13Naip1-Naip5)1Vnce
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Del(13Naip1-Naip5)1Vnce
Name: deletion, Chr 13, Russell Vance 1
MGI ID: MGI:6246513
Synonyms: Naip1-6delta
Gene: Del(13Naip1-Naip5)1Vnce  Location: Chr13:100382831-100544278 bp  Genetic Position: Chr13, Syntenic
Mutation
origin
Strain of Origin:  B6(Cg)-Tyrc-2J/J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intergenic deletion, Intragenic deletion
  Del(13Naip1-Naip5)1Vnce involves 4 genes/genome features (Naip5, Naip6, Naip3 ...) View all
 
Mutation detailsA single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) in each of the four functional mouse Naip genes (Naip1, 2, 5, and 6). The sequence between Naip5 exon 6 and Naip1 exon 6 was deleted including Naip3 and Naip6, leading to a nonfunctional fusion of Naip5 and Naip1. (J:233320)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Del(13Naip1-Naip5)1Vnce Mutation:  1 strain or line available
References
Original:  J:233320 Rauch I, et al., NAIP proteins are required for cytosolic detection of specific bacterial ligands in vivo. J Exp Med. 2016 May 2;213(5):657-65
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/18/2022
MGI 6.17
The Jackson Laboratory