About   Help   FAQ
Snx14em1(IMPC)H
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Snx14em1(IMPC)H
Name: sorting nexin 14; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6153823
Gene: Snx14  Location: Chr9:88376755-88438929 bp, - strand  Genetic Position: Chr9, 47.24 cM
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCCCGAATGGACTACTCTGCGAT, CCGAATGGACTACTCTGCGATAC, GTAGAAAGTGTAGCCGGGCGTGG, CTTTAATCCCAACACTCGGGAGG, which resulted in a Exon Deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Snx14 Mutation:  1 strain or line available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory