Zmynd19^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zmynd19^em1(IMPC)J
• Name: zinc finger, MYND domain containing 19; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907980
• Gene: Zmynd19 Location: Chr2:24839789-24850882 bp, + strand Genetic Position: Chr2, 16.86 cM
• Alliance: Zmynd19^em1(IMPC)J page
• IMPC: Zmynd19 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAGGACCCCAAAAGTACAG, TCCGTTCTGGACTTTTTTAA, GTAACCTATGACTCACCAGA and GAGCTTTGCCACTAACCCAA, which resulted in a 461 bp deletion beginning at Chromosome 2 positive strand position 24952462 bp, TACTTTTGGGGTCCTAGGAG, and ending after TGAGACCCATGGATCCTTCT at 24952922 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261744 (exon 3) and 354 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 76 bp insertion into the site of the deletion that is an inverted repeat from Chr2:24952847-24952922 (AGAAGCTTTG). The insertion is not expected to alter the results of the exon deletion, which is predicted to cause a change of amino acid sequence after residue 37 and early truncation 39 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zmynd19 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)