Zmynd19em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zmynd19em1(IMPC)J |
| Name: |
zinc finger, MYND domain containing 19; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5907980 |
| Gene: |
Zmynd19 Location: Chr2:24839789-24850882 bp, + strand Genetic Position: Chr2, 16.86 cM
|
| Alliance: |
Zmynd19em1(IMPC)J page
|
| IMPC: |
Zmynd19 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAGGACCCCAAAAGTACAG, TCCGTTCTGGACTTTTTTAA, GTAACCTATGACTCACCAGA and GAGCTTTGCCACTAACCCAA, which resulted in a 461 bp deletion beginning at Chromosome 2 positive strand position 24952462 bp, TACTTTTGGGGTCCTAGGAG, and ending after TGAGACCCATGGATCCTTCT at 24952922 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261744 (exon 3) and 354 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 76 bp insertion into the site of the deletion that is an inverted repeat from Chr2:24952847-24952922 (AGAAGCTTTG). The insertion is not expected to alter the results of the exon deletion, which is predicted to cause a change of amino acid sequence after residue 37 and early truncation 39 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|