Clptm1lem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Clptm1lem1(IMPC)J |
Name: |
CLPTM1-like; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5817176 |
Synonyms: |
Clptm1lem1J |
Gene: |
Clptm1l Location: Chr13:73752125-73768724 bp, + strand Genetic Position: Chr13, 40.12 cM
|
Alliance: |
Clptm1lem1(IMPC)J page
|
IMPC: |
Clptm1l gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Clptm1l-8201J-M4248 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCCAAGCTCACCCTCTGAG, GTTTCCTAACGGGACCCCAG, ACTGCAATCTAAGGGCAGCG and ATAGCATTGTATGTAGAGTG, which resulted in a 377 bp deletion beginning at Chromosome 13 positive strand position 73,604,838 bp GAGAGGTAGCCCTCAGATTG, and ending after ATCTAAGGGCAGCGTGGTTT at 73,605,214 bp (GRCm38/mm10). This mutation deletes exon 2 and 441 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 2 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|