Kctd9em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Kctd9em1(IMPC)J |
Name: |
potassium channel tetramerisation domain containing 9; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5784897 |
Synonyms: |
Kctd9em1J |
Gene: |
Kctd9 Location: Chr14:67953536-67979760 bp, + strand Genetic Position: Chr14, 34.66 cM
|
Alliance: |
Kctd9em1(IMPC)J page
|
IMPC: |
Kctd9 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Not Specified
|
|
|
Mutation details: This allele from project Kctd9-7773J-M6328 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGCGCTGAATCTCCTCAA, GCACAGAGTAATTGCCTATC, ACTAGTGACAGCCTTAGAAA and CAGCAGTGACACTACAGCAT, which resulted in a 277 bp deletion around exon 2 beginning at Chromosome 14 positive strand position 67,724,474 bp, CTCCTCAAGGGTCTCTTAAG, and ending after TGAGCTGTCTGTCACCTATG at 67,724,750 bp (GRCm38/mm10). This mutation deletes exon 2 and 155 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single base pair (C) deletion in the intron 42 bp before the 277 bp deletion that is not expected to alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 16 and early truncation 1 amino acid later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|