About   Help   FAQ
Ustem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ustem1(IMPC)J
Name: uronyl-2-sulfotransferase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5749738
Synonyms: Ustem1J
Gene: Ust  Location: Chr10:8080520-8394589 bp, - strand  Genetic Position: Chr10, 2.65 cM
Alliance: Ustem1(IMPC)J page
IMPC: Ust gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ust-7382J-F715 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATTTGAGTAAGCTGTTAAG, TGATTTGAGTAAGCTGTTAA, ACAGCTGAGCTTGTTGCAAA, and GGCAGATAACCATTAGCGTG, which resulted in a 221 bp deletion spanning exon 4 beginning at Chromosome 10 negative strand position 8,307,547 bp, TTAGCGTGTGGCTTAGAGAG, and ending after GCTCCATCTAATGAGCAACCCCT at 8,307,327 bp (GRCm38/mm10). This mutation deletes exon 4 and 141 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 150 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ust Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/19/2024
MGI 6.23
The Jackson Laboratory