Ustem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ustem1(IMPC)J |
Name: |
uronyl-2-sulfotransferase; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5749738 |
Synonyms: |
Ustem1J |
Gene: |
Ust Location: Chr10:8080520-8394589 bp, - strand Genetic Position: Chr10, 2.65 cM
|
Alliance: |
Ustem1(IMPC)J page
|
IMPC: |
Ust gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Ust-7382J-F715 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATTTGAGTAAGCTGTTAAG, TGATTTGAGTAAGCTGTTAA, ACAGCTGAGCTTGTTGCAAA, and GGCAGATAACCATTAGCGTG, which resulted in a 221 bp deletion spanning exon 4 beginning at Chromosome 10 negative strand position 8,307,547 bp, TTAGCGTGTGGCTTAGAGAG, and ending after GCTCCATCTAATGAGCAACCCCT at 8,307,327 bp (GRCm38/mm10). This mutation deletes exon 4 and 141 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 150 and early truncation 17 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|