Abca9em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Abca9em1(IMPC)J |
Name: |
ATP-binding cassette, sub-family A member 9; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5649019 |
Synonyms: |
Abca9em1J |
Gene: |
Abca9 Location: Chr11:109991575-110059022 bp, - strand Genetic Position: Chr11, 73.22 cM
|
Alliance: |
Abca9em1(IMPC)J page
|
IMPC: |
Abca9 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Abca9-6893J-M2445 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, ACAATCTCATCAGTCAACTC, CATTATCTCATGGGTGGCTT and CTTTTAAGTACTTGACTCTA, which resulted in a 467 bp deletion beginning in intron 3 at Chromosome 11 negative strand position 110,163,505 bp, at TTAAAAGTGGAGAAACTTAAATGG, and ending after CTGATGAGATTGTTGGAC at position 110,163,039 bp in intron 4 (GRCm38). This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 33 and early truncation 11 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|