Chn1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Chn1em1(IMPC)J |
Name: |
chimerin 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5644468 |
Synonyms: |
Chn1em1J |
Gene: |
Chn1 Location: Chr2:73441004-73605690 bp, - strand Genetic Position: Chr2, 43.78 cM
|
Alliance: |
Chn1em1(IMPC)J page
|
IMPC: |
Chn1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele from project Chn1-6579J-M1939 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, TTTAAGCAGTCTCGGTGAAA and CCAAGGACATCAGCTCTTGG, (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon which did not integrate) which resulted in a 403 bp deletion and a 12 bp insertion of ttaagccaagtc in exon3 beginning at Chromosome 2 negative strand position 73,716,700 bp, GAAAAGGTTGTTTAATCACCA, and ending after TCCCAAGAGCTGATGTCCTT at 73,716,298 bp (GRCm38/mm10). This mutation deletes exon3 and is predicted to cause amino acid sequence changes after residue 19 and early truncation 17 amino acids later. PCR failed to detect the insertion of any loxP sites.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|