About   Help   FAQ
Tyrem3J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Tyrem3J
Name: tyrosinase; endonuclease-mediated mutation 3, Jackson
MGI ID: MGI:5470270
Gene: Tyr  Location: Chr7:87073979-87142720 bp, - strand  Genetic Position: Chr7, 49.01 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis zinc finger mediated allele was generated at The Jackson Laboratory and is a 24 bp deletion of AGGGACCACTATTACGTAATCCTG from Chromosome 7 negative strand position 87,483,953 bp through 87,483,976 bp (GRCm38/mm10), which results in a recessive albino phenotype. This is predicted to cause an 8 amino acid in-frame deletion of amino acids 295-302, GPLLRNPG, near the center of the di-copper centre-containing domain, but is not predicted to cause a premature truncation or frameshift. (J:208906)
Inheritance:    Recessive
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tyr Mutation:  357 strains or lines available
References
Original:  J:208906 Murray SA, Endonuclease-induced mutations in tyrosinase. MGI Direct Data Submission. 2014;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory