About   Help   FAQ
D19Mit11-pA, D19Mit11-pB Primer Detail
Primers
  • Name
    D19Mit11-pA, D19Mit11-pB
  • Primer 1 Sequence
    TATCCTCAAAGTCAAGGTGGGCAGCTGAGG
  • Primer 2 Sequence
    TTATGTTGGAAGACTTTCCAGATGTTGGGC
  • ID
    MGI:7735
  • Other IDs
    D19Mit11-pA (BROAD)
    D19Mit11-pB (BROAD)
Genes
D19Mit11.2 DNA segment, Chr 19, Massachusetts Institute of Technology 11.2
References
J:20807 Keller SA, et al., Kidney and retinal defects (Krd), a transgene-induced mutation with a deletion of mouse chromosome 19 that includes the Pax2 locus. Genomics. 1994 Sep 15;23(2):309-20
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/09/2024
MGI 6.23 		The Jackson Laboratory