D9Mit191 Primer Detail MGI Mouse MGI:707605

D9Mit191 Primer Detail

Name

D9Mit191
Primer 1 Sequence

GTAAGTATGCCTGCGGAGGA
Primer 2 Sequence

CAGAAGACCGCTTTTCAAGG
ID

MGI:707605
Product Size

146
Other IDs

D9Mit191 (BROAD)
Note

MIT assay: MT2144
Additional information: MIT STS Marker Data Files

D9Mit191

DNA segment, Chr 9, Massachusetts Institute of Technology 191

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit191	a	147bp	129X1/Sv
Not Specified	D9Mit191	f	99bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit191	a	99bp	AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	b	115bp	C57BL/6J
	c	137bp	A/J
	d	147bp	B6.Cg-Lep^ob/+, DBA/2J, SPRET/EiJ
	e	157bp	CAST/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D9Mit191	c	larger	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit191	c	98bp	CBA/CaOlaHsd
	D9Mit191	s	88bp	SWR/OlaHsd

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit191	c	lower	CBA/Kw
	D9Mit191	e	upper	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23