D11Mit217 Primer Detail MGI Mouse MGI:707216

D11Mit217 Primer Detail

Name

D11Mit217
Primer 1 Sequence

ACTGGAAAATATGTTTTAAACCTCTG
Primer 2 Sequence

AAATGGGATTCTGCAAAAACC
ID

MGI:707216
Product Size

135
Other IDs

D11Mit217 (BROAD)
Note

MIT assay: MTAR155
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 217

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D11Mit217	b	larger than f	C57BL/6J
	c	138bp	C3HeB/FeJLe
	f	smaller than c and b	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit217	a	118bp	DBA/2J
	b	122bp	AKR/J, NOD/MrkTac, NON/ShiLt
	c	138bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	d	140bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	144bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23